benjaminlehman2001 benjaminlehman2001

24-10-2018
Mathematics

contestada

Find the slope point-slope equation of a line that gas a slope of -2 and passes through the point

Respuesta :

BasketballEinstein BasketballEinstein

29-10-2018

There are no given coordinates, so it's impossible to answer your question. I'm sorry.

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

what is 0+50×1-60×0+10=

elevated blood cell count can be a result of: A. bacterial infection B. viral infection C. parasitic infection D. immune hypersensitivity/ allergic reactions E.

what process releases the least atp per molecule of glucose for immediate cell use?

Can anyone to correct it if necessary?

what came first the chicken or the egg

what type of sentence tends to express a strong emotion

why are cancer causing factors in lifestyle and environment difficult to identify

write a sentence with the word labyrinth

Describe two ways in which bacteria and the fungus Penicillium are similar? Describe two ways in which bacteria and the fungus Penicillium are different?