p2nk p2nk
  • 21-03-2024
  • Mathematics
contestada

find the difference 6 2/9 -5 3/9

Respuesta :

Otras preguntas

if if x+y=10, find the value of y when x=3
Factor 3s+27t. Please help me I was absent for about a week with a high fever when she taught this lesson. I'm on 73% on IXL so PLEASE HELP!
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
can you please help me please
A single stranded DNA has a base sequence of 5'GACTCCGTAACGGTTAACC3'.What DNA sequence will base pair
A parking lot in the shape of a trapezoid has an area of 12,052.1 square meters. The length of one base is 82.4 meters, and the length of the other base is 108.
· Heart muscle receives its oxygen and nutrient supply from o atria o ventricles o aorta o pulmonary veins o coronary arteries · The "cushion" between bones in
Who is Christina LeConte
why are cancer causing factors in lifestyle and environment difficult to identify
Find the smallest zero for the function h(x) = 4x^2 - 8x - 60