lillierudloff4158 lillierudloff4158

22-03-2024
Arts

contestada

Basic design and composition: lines are "....

Respuesta :

Otras preguntas

The height of a cylinder is 5 centimeters. The circumference of the base of the cylinder is 16 centimeters. Find the lateral surface area of the figure. Draw th

What is the volume of a sphere with a surface area of 64 cm??

Two positively charged particles are separated on an axis by 0.1 meters; q1 has a 3 microcoulomb charge and q2 has a 2 microcoulomb charge. Recall that k = 8.99

In gymnosperms and angiosperms, seeds disperse the ________ stage of the life cycle and in mosses and ferns, spores disperse the ________ stage of the life cycl

What is the quotient of a^3b/c^2 / 2ab/c^3 ? Assume a0, b0, and c0. a2c a3bc

The table shows the participation in a school’s debate club during the last four years. Year 1 2 3 4 Students 14 19 25 33 Between which two years did the club s

If you saw this strand of DNA how many base pairs would be in thestrand?aagcttctgaatcagttcgaagacttagtc

A client with atherosclerosis asks a nurse which factors are responsible for this condition. What is the nurse’s best response? a. "Injury to the arteries cause

The table shows the average number of hours different students spend on the computer each day. Average Time (hours) 1.6 2.0 1.5 1.6 1.6 1.8 2.0 1.8 2.0 1.9 1.6

You need to repaint the floor and inside wall of your circular swimming pool. It has a diameter of 16 feet and a depth of 5 feet. What is the surface area that