lolserialstudytiem lolserialstudytiem

24-03-2019
Mathematics

contestada

(LOOK AT PIC) find the surface area of the figure

LOOK AT PIC find the surface area of the figure class=

Respuesta :

astonmartinmclaren astonmartinmclaren

24-03-2019

Answer:

Step-by-step explanation:

SA = 2b+2(h*l)+hypotenuse*h

= 16*3+2(120)+192

= 48+240+192

=480

Answer Link

Otras preguntas

Codons Which amino acids does this mRNA strand code for? *You must spell out the entire name of the amino acid* 5'CCGGAUGUCCGUAUAACGGC3'

Rectangle STUV is shown on a coordinate plane. Rectangle STUV with vertices S at negative 7 comma 6, T at negative 2 comma 6, U at negative 2 comma 1, and V at

The advertiser is responsible for Blank______ in a sole sponsorship.a. only the total cost of production the program content aloneb. neither the content nor the

Which of the following was NOT believed to be a reason for the decline of the kingdom of Zimbabwe? O Decline in population O Portuguese exploration for gold O L

Pre-Test Active 1 2 3 The feeling of fervent devotion toward one's nation above all others is known as

The command line interface in macOS is known as? 1) Terminal 2) Linux 3) Oracle 4) Command Line

Comparing the relativistic kinetic energy of a massive particle, m( γ-1)c², with the classical (non-relativistic) kinetic energy, write the first few terms of t

Determine which of the following will least likely donate an electron? O H₂ O Br₂ O Zn2+, O Cl₂ O Li+

Please answer fast Need help on math

Find the derivative of (x²+16)/(x)?