jes2227 jes2227
  • 25-10-2019
  • Spanish
contestada

Ayer yo ___ la verdad

Respuesta :

gdczr gdczr
  • 25-10-2019

Answer: dije

Explanation: Dije means said. Yesterday, I said the truth.

Answer Link
meryisqueen2007
meryisqueen2007 meryisqueen2007
  • 25-10-2019
Dije because this means said
Answer Link

Otras preguntas

help plss i don't get it can yall plz help
Let F(x) = 2x2 + x - 3 and g(x) = x - 1. f(x) g(x)Find and state its domain.Answers:1) X - 1; domain is the set of all real numbers2) (x-1)/(2x + 3) ; domain is
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid
Carlos, a network technician, replaces a failed switch with a new switch. Carlos informs the users on the subnet served by the switch that they can reconnect to
The Venn diagram above shows the results of a survey of 200 readers on the type of magazine they read. If a respondent is chosen at random, what is the probabil
What's the best way to show a complex data chart in Word? a) You can't present complex data charts in Word. b) Storing data in a separate Excel file and copy
4x-2 3x+14 how do I find x?
lol help pleas jdcbfjvbcjvdj
jion my blooklet code:173650 this is a question game
Which of these is a prepositional phrase? (A). two benches (B). in the garden (C). to receive the children (D). waited