luvxmimi luvxmimi

23-04-2020
Biology

contestada

Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC

Respuesta :

Аноним Аноним

23-04-2020

Answer:

This is the mRNA strand

Explanation:

AUGGGUAAUGCGCCUUCGCAUUAAUG

Answer Link

StephanyNo StephanyNo

23-04-2020

AUGGGUAAUGCGCCGUUCGCAUUAAUG

Answer Link

Otras preguntas

Which factor most greatly limits the power of the US government?

The position of czar was abolished at the end of which war? a. Russo-Japanese War b. World War I c.World War II d.Cold War.

compare and contrast area and volume

The number of grocery items on two grocery lists differs by 7. the total number of items is 33. How many items are on each list?

One number is 4 less than 3 times a second number. If 3 more than two times the first number is decreased by two times the second, the result is 11. What are

table salt, NaCl Give only the names of the elements alphabetically, separating them with commas.

What is the difference between polytheism and monotheism? A. Polytheism is the worship of earth gods. Monotheism is the worship of water gods. B. Polytheism

why its important that skull joints cannot move

Which are associated with the Hebrew people? Choose all answers that are correct. A. worshiped many gods including Re, Osiris, and Horus B. compiled the Torah a

Which is the best source of a historical evidence to learn about how an event unfolded? A) a historical novel that takes place during the event B) a political