marjorietimothee1 marjorietimothee1

24-04-2020
Mathematics

contestada

Nando has 2 goldfish. Jill has 5 goldfish Cooper has 2 times as many goldfish as Nando and Jill combined

Respuesta :

katrina167 katrina167

24-04-2020

Nando has 14 goldfish.

2+5=7 7*2=14 Tge answer is 14

Answer Link

adbrown7443 adbrown7443

24-04-2020

Answer:

cooper has 14 goldfish

Step-by-step explanation:

2+5=7

7*2=14

answer-14

Answer Link

Otras preguntas

Lexington County Army Air Base in Columbia South Carolina bears the distinction of being one of the training sites for A) the Tuskegee Airmen. B) Doolittle

what does hafa adai mean in guamanian

A single stranded DNA has a base sequence of 5'GACTCCGTAACGGTTAACC3'.What DNA sequence will base pair

Hydrogen peroxide decomposes to give water and oxygen gas according to the equation below. If 3.0 moles of hydrogen peroxide decompose, what volume of oxygen ga

If you drink a soda with sugar, what happens to your blood glucagon levels?

What is the primary way that combination birth control pills work to prevent pregnancy?

how to find the average range of cells A1:A10

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

If 1+4=5 and 2+5=12 what does 8+11=

What is one of the main differences between the phosphorus and sulfur cycles? A) Plants absorb phosphorus mainly from the air and sulfur mainly from the soil