saulbustamante saulbustamante

21-05-2020
Biology

contestada

Traits will sort themselves into gamete independently of what other traits are doing.” This is Mendel’s law of __________.

Respuesta :

jennelleleah jennelleleah

21-05-2020

Answer:

independent assortment

Explanation:

Answer Link

Otras preguntas

If a solution is made with 860 grams of table salt(NaCl) in 300 ml of water, what is the molarity of the solution

Codons Which amino acids does this mRNA strand code for? *You must spell out the entire name of the amino acid* 5'CCGGAUGUCCGUAUAACGGC3'

Disminución de la cognición y la memoria, además se alteran las funciones motoras.

you could help meHe world suggest a solution to a problem they would do social work your father will take us to the park you could come to meet me

A wood beam with cross-sectional dimensions 200mm x 300mm is reinforced on its sides by steel plates 12mm thick. The moduli of elasticity for the steel and wood

Natural selection requires variations: differences between members of the population. Organisms are born with different random variations, which may be helpful,

Demonstrate whether the "put-call parity relationship" exists. Show all work calculations. (NOTE: If the calculations are off by < 1-2

Bob only has 9 pencils today. He has 15% of the total pencils he had last week. How many pencils did he have last week

The learning chapter primarily covers which of the following? a. Conditioning b. Individual learning styles c. Memory d. All of the above

Consider line CD passing through points C(-5, 10) and D(1,8). What is the slope of CD? Оз 0-3 73