helenirby1964 helenirby1964

22-05-2020
Chemistry

contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof

22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

A football is kicked with an initial velocity of 50.0 m/s, 60° above the horizontal line. Find the following: The time it takes to reach the maximum height; The

What is the value of a if 5a = 1/125 (It’s not 1/625) Please answer!!

Write a different title for the story, "The Duel." In a short essay, explain why your title is more appropriate.

write one paragraph and use MLA format, including a Works Cited page and properly formatted in-text citations that are formatted with signal phrase + paraphrase

SIMPLIFIED POLYNOMIALS. Combine all the similar terms of each polynomial 1. 4x + 2x - 3x 2. 10xy + 4y - 8xy + 9y 3. 6x2 + y - 8x2 + 2 + 3y 4. 14a3 - a2 + 3a2 -

Please I don’t know this What is the y-intercept of a graph showing direct variation?

Consider the line y = 3/5x + 4. Find the equation of the line that is parallel to this line and passes through the point left (- 5,-1)

SIMPLE INTEREST:Jessie deposited P150,000 in an account that pays 3% simple interest.How much interest will he earn after 10 years?

Grace wishes to buy a corporate bond with a par value of $1,000 from SFT Legal. If Graceâ€™s broker charges her a commission of 4% of the market value of each b

for the equation y=ax^2 how does the sign of coefficient affect the graph of the curve