ksantiago0024 ksantiago0024
  • 25-05-2020
  • Chemistry
contestada

how much sugar does a sparkling water contain need help

Respuesta :

randomperson76 randomperson76
  • 25-05-2020
0 grams! no evidence shows it’s unhealthy and google backed me up
Answer Link

Otras preguntas

1+4=5 2+5=12 3+6=21 8+11=
what would you call a object that makes people shut up
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
15% of 6758 for fun. lets see if you can answer this
to increase an amount by 85% what single multiplier would i need to use?
What does the term human rights mean
Look At The Picture. Thats The Question I Need Answered ASAP
why are cancer causing factors in lifestyle and environment difficult to identify
what would you call a object that makes people shut up
why are cancer causing factors in lifestyle and environment difficult to identify