naviahbrad naviahbrad

22-06-2020
Mathematics

contestada

Quadrilateral
Wy has vertices W. 19), X10, 10x10,2), and 32,2). Determine if quadrilateral WXYZ is a rhombus,

Respuesta :

jamjambecle jamjambecle

28-06-2020

Answer: no it’s not

Step-by-step explanation:

it’s a square

Answer Link

Otras preguntas

Siri has half the amount of quarts in a gallon how many cups are in those quarts if there are 4 quarts in a gallon

Lexington County Army Air Base in Columbia South Carolina bears the distinction of being one of the training sites for A) the Tuskegee Airmen. B) Doolittle

Approximately, where do the numbers in the first file go in the second file's number line?If possible, post a number line like mine onto your answer and make ar

Sound travels at a rate of 340 m/s in all directions through air. Matt rings a very loud bell at one location, and Steve hears it some time later at his locatio

find the quotient of 3870 and 18

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

How do short-term goals differ from long-term goals?

in a beauty contest, half of the judges voted for miss.a .2\3 of them voted for miss.b., 10 voted for both and 6 did not vote for either miss.a or miss.b.find h

In a recent year, certain colleges and universities received about $268 million in aid. Ten years later, they received about $94 million. Find the percent of ch

which branch of central government makes/enact/ passes laws