montgomerybunston montgomerybunston
  • 22-09-2020
  • Biology
contestada

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Respuesta :

oceanbluewater3000 oceanbluewater3000
  • 22-09-2020

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer Link

Otras preguntas

how to solve 2/3 of 2/3
what is 8 divided by 2 and 1/2? A. 20 B. 2 and 1/5 C. 40 D. 3 and 1/5
if average of m numbers is n^2 and average of n numbers is m^2 then average of m+n numbers is
what is 8 divided by 2 and 1/2? A. 20 B. 2 and 1/5 C. 40 D. 3 and 1/5
what is the slope of the graph of 4x-16y=15
Which substance below will exhibit hydrogen bonding between the molecules of the substance? a. CH₄ b. HBr c. HCl d. H₂O e. H₂
The lengths of the legs of a right triangle are 15 cm and 20 cm. What is the length of the hypotenuse?   A.
How did Roosevelt's policies help the conservation of natural resources?
The area of a circle is 12.56 square miles. What is the circle's radius?Use 3.14 for
Choose the absolute value inequality that corresponds to the given compound inequality.–5 < x + 2 < 9