crisosafire crisosafire

23-10-2016
Mathematics

contestada

What is the mean of the data without the outlier included?

Respuesta :

ThomasTheTank ThomasTheTank

23-10-2016

I think the mean with outliers excluded are called trimmean.

Answer Link

Otras preguntas

how to find the average range of cells A1:A10

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

what is the solution of the following question? x^2+10x+25=12

Please help me with this question

(TCO 4) Which of the following creates thymine dimers? (Points : 4) Nucleotide analogs Nitrous acid Ultraviolet light Benzopyrene Gamma rays

Identify the parts of the human body that normally contain bacteria

What event takes place in the second entry of Anne Frank's dairy?

Could someone help with the questions in the images below? Some I have already completed - please let me know if they are right! and the others are blank.

Derek is deciding what to wear to school. He has a green shirt, a purple shirt, and a red shirt, and he has beige, gray, and blue pants. He also has sandals, ru

What impact did Babe Ruth have on the society/country?