jaronolaysyt jaronolaysyt

25-03-2021
Mathematics

contestada

Find the length of the missing side to the nearest tenth a = 11 and c = 61

Respuesta :

Аноним Аноним

25-03-2021

Answer:10 and 60

Step-by-step explanation:

Well if we're rounding to the nearest tenth 11 would become 10 and 61 will become 60

Answer Link

Otras preguntas

What domain did sues rule?

What did Anti-Federalists fear would happen if the Constitution became law?

Color ___ indicates that one color is dominating a picture.

Why would Congress not seat newly elected senators and representatives from southern states?

the most important benefit a dificult amendment process is that it

tips para perder el miedo a un sismo o terremoto y planes de evacuacion como el triangulo de la vida y kits de emergencia

why does a virus stay in a person for life, such as hepatitis

I only need to know the answers to numbers 9 and 10 The problems are the ones circled in the photo

dont knwo the answers for question 4,5,6

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC