makaylamays6733 makaylamays6733
  • 24-04-2021
  • Mathematics
contestada


Helpppp!! which one is true

Helpppp which one is true class=

Respuesta :

Аноним Аноним
  • 24-04-2021

Answer:

Option C.J'K'L'M' will still be a rectangle, angles are preserved opposites sides remain equal in lengths and parallel.

Step-by-step explanation:

hope it helps...

have a great day!!

Answer Link

Otras preguntas

tthe pave away company is installing a new walk way the installer uses 13 paving stones for every foot of walkway he needs 117 paving stones to complete the pro
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
Which quotation from “Rikki-Tikki-Tavi” contains a simile? A. “He came down almost across her back, and if he had been an old mongoose he would have known tha
I know I have the body but of a weak and feeble woman; but I have the heart and stomach of a king, and of a king of England too, and think foul scorn that Parma
#9: Solve the linear system below using the elimination method. Type your answer as an ordered pair in the form (#,#). -4x - 9y = -3 - 4x + y = -13 (ALOT OF POI
ilustreaza in cel putin 100 de cuvinte 2 trasaturi ale basmului.
The frequent repetition of an act, to the extent that it becomes characteristic of a group of people, is a.
help with question 14?
help once again. this is 6th grade work so uhh help
can you form a triangle from 60°, 60° and 60°? yes or no