rindal201064
rindal201064 rindal201064
  • 25-09-2021
  • Mathematics
contestada

Can anyone help with this pls

Can anyone help with this pls class=

Respuesta :

jade7387
jade7387 jade7387
  • 25-09-2021
The diamond is 1 the square is 6 and the triangle is 7
Answer Link

Otras preguntas

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul
Randomized block design: Researchers interested in identifying the optimal planting density for a type of perennial grass performed the following randomized exp
mrs. x tries to recall her new cell phone number. all that she can recall, however, is her old cell phone number. here, we have a clear example of interference,
code a function definition for a function named shiftdiagonal which does the following: 1) accepts an x coordinate, y coordinate and amount to shift them by. 2)
box is moving at a constant velocity static friction is 0.35 what does it take to accelate it at 1.2
what do you mean by savage ???​
Compare and contrast the Mayan and Aztec society. What were the main characteristics of Mayan society? How was religion central to their cities, politics and s
Two events occur 100 m apart with an intervening time interval of 0.60 µs. The speed of a reference frame in which they occur at the same coordinate is: 1.1c 0
TRUE/FALSE. under the principle of rights theory, one person’s principles are as "right" as another’s.
which of the molecules or ions below will have the shortest nitrogen-oxygen bond? no, no2 −, no3 −