dominic691442 dominic691442
  • 24-10-2021
  • Mathematics
contestada

solve pls brainliest

solve pls brainliest class=

Respuesta :

lazymf
lazymf lazymf
  • 24-10-2021

(a) 305 (?)

(b) Fields, monroe

(c) Treevale

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
what process releases the least atp per molecule of glucose for immediate cell use?
what Is the difference between organic and inorganic matter?
​What is the primary way that combination birth control pills work to prevent pregnancy?
Assuming the average composition of air weighs approximately 0.0807 lbs per cubic foot, what is the weight of air in a giant spherical balloon with a diameter o
8 1/4 in simplest form
Assuming the average composition of air weighs approximately 0.0807 lbs per cubic foot, what is the weight of air in a giant spherical balloon with a diameter o
Dory and Nemo go to Taco Bell for lunch. Dory orders three soft tacos and three double deckers for $11.25. Nemo pays $10.00 for four soft tacos and two Double D
. Green swordtails are sexually dimorphic: males have a long, swordlike projection from their tails, and females have rounded tails. An experimenter decides to
in millions of british pounds how much did germany spend in 1890