brandoncolclough597 brandoncolclough597

22-11-2021
World Languages

contestada

What word could you spell with asaeeccnieorstn that is a child delevopment word

Respuesta :

kailemontefalco kailemontefalco

22-11-2021

Answer:

Synonyms for CHILD: bairn, bambino, bud, chap, chick, cub, juvenile, kid; Antonyms for CHILD: adult, grown-up, antecedent, causation, cause, occasion, reason Child: a young person who is between infancy and adulthood.

Explanation:

Answer Link

Otras preguntas

What are two adjectives for the word Black hawk?

Which of the following tactics do food manufacturers use to try to get you to buy their products? a. TV and radio commercials b. all of the above c. coupons d.

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Explain the relationship between osmosis and aquaporins.

Can somebody please explain to me how the acceleration in simple hormonic motion is proportional to the displacement..

What is the effect of using scaffold proteins on precision and amplification capacity in cell signaling?

1+4 = 5. 2+5=12. 3+6=21 8+11==?

I need help please what are some negative effects of stress on an individual? For this discussion, I would like everyone to explain how stress affects an indivi

Indigenous North American societies recognized and even valued a gender status known as (Points : 1) intersexuality. Two Spirits. Hij

Which prefix means 1/10 of a unit in the metric system