monte5514 monte5514

26-01-2022
Mathematics

contestada

Which term describes a fraction that has a polynomial in its denominator

Respuesta :

730002598 730002598

26-01-2022

Answer:

60

Step-by-step explanation:

it is like that just because

Answer Link

Otras preguntas

Who was the botanist that traveled down the Canadian River and called the lands that he saw in Oklahoma the “Great American Desert”? A. Peter Custis B. George S

The Alien and Sedition Acts allowed the President to arrest and deport enemy immigrants in the event of war and made it a crime to print "any false, scandalous,

Help math word problem

greatest to least 3.008 3.825 3.09 3.18

Who invaded northern India in the fifteen twentys and established the Mughal dynasty?

at first, the ratio of john’s money to peter’s money was 4:7 . after john spent half of his money and peter spent $60, peter had twice the amount of money as jo

the biggest diamond ever found weighed about 1 and 1/2 lb uncut diamond were cut into 6 equal pieces how much would each piece weigh

Find LM. Please show how you got to the answer too, thanks!

DNA tacaggtacccgaacccaattta

When Daisy tells Gatsby, “You always look so cool,” what does she reveal to Tom?