emmrichardson6 emmrichardson6
  • 24-03-2017
  • Biology
contestada

Name 3 characteristics that make the gas giant planets so different from the terrestrial planets.

Respuesta :

seuchiii
seuchiii seuchiii
  • 24-03-2017
Not sure if there are any answer choices to chose from, but I would say ;
1: Terrestrial planets are much smaller than Gas Giants.
2: Gas Giants Have a lower temperature compared to Terrestrial Planets
3: Gas Giants are the only planets with rings, Terrestrial don't have rings. Hope this helped :)
Answer Link

Otras preguntas

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
A force of 18 lb is required to hold a spring stretched 2 in. beyond its natural length. How much work W W is done in stretching it from its natural length to 7
Jade recorded how many characters she used in each of her 9 most recent text messages. Here's a histogram showing her data: # of messages 2 0 0 20 40 60 80 100
Help me please i really need it​
Help help hep hep math
which term defines the distance from crest to crest or from trough to trough in a wave?
Why did the KKK burn crosses
Help help history please please please
please help me and solve it
Due to animal rescue efforts, sea turtles have made a comeback and are no longer on the endangered list. What does comeback mean? (1 point) A cause for complain