cgarcia7953 cgarcia7953

27-05-2021
Mathematics

contestada

Simplify 2/5 (40x – 75)
which one ?? help plsss
100x - 187.5
80x/5 - 150/5
80x - 150
16x-30

Respuesta :

clarch19 clarch19

28-05-2021

Answer:

16x-30

Step-by-step explanation:

distribute 2/5 by 40x and then 75

2/5(40x) - 2/5(75)

16x - 30

Answer Link

Otras preguntas

Help ASAP!!!!!!!!!!!

If the hawks have won 12 games which is 60% of the games this season, how many games have they played this season

XYZ, Ltd., uses 36,000 units of a product each year. Carrying costs are $1.20 per unit a year, and ordering costs are $96. If XYZ orders 1000 to 1999 units, the

Create a conditional formatting rule that highlights the whole row for a product that should be discarded

Which of the following statements describes the decision facing L.L. Bean?

Evolutionary algorithms utilize all of the following EXCEPT? 1) Enumeration of extreme points 2) Mutation 3) Crossover 4) Determining the "fitness" of each cand

The communication process consists of ______ steps, each of which is vital to the effectiveness of the communication encounter.

According to the EPA, which MSW material accounts for the greatest percentage in a landfill in 2018

Codons Which amino acids does this mRNA strand code for? *You must spell out the entire name of the amino acid* 5'CCGGAUGUCCGUAUAACGGC3'

An opening sentence or two describing the two companies (Ryder and Kodiak Robotics), their position in the industry (financial and market size) and their years